Hammerhead Ribozyme Insulator
RiboJ
Data
| Strain | NEB 10-beta |
|---|---|
| Plasmid | pJS |
| ori | p15A |
| Resistance | Clo |
Description
Part of a collection of Hammerhead ribozyme-based insulators, which are used for combinatorially insulating NOT gates in the Cello CAD, developend by the Voigt lab at MIT. RiboJ, a hammerhead ribozyme derived from the satellite RNA of tobacco ringspot virus, was initially validated in another study by showing its ability to insulate gene expression from promoter 5'UTR interference. Variants were then found by part mining or created through mutation of the RiboJ scaffold.
Characterization
Parts were characterized on E. coli NEB10-beta in M9 glucose media at 37°C in 96-well flow citometer assays.The parts were characterized similarly to a previous work, by comparing gene expressions with different promoter-CDS combinations. Specifically, the authors tested the ribozymes by expressing GFP and cI-GFP with either PLacO1 or PTac promoters. All insulators were sufficiently effective, recovering the gene expression from the uninsulated state and making expression predictable.
Sequences
Insulator
agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa
Reference
Nielsen, A. A. K. et al. Genetic circuit design automation. Science 352, aac7341 (2016).
https://doi.org/10.1126/science.aac7341Extra References and External Links
Lou, C. et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat Biotechnol. 30(11), 1137–1142 (2012).
https://dx.doi.org/10.1038%2Fnbt.2401